feuA [2020-09-03 16:13:06]

ABC transporterfor the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein), with YusV as ATPase

Locus: BSU_01630

Isoelectric point: 8.02

Molecular weight: 34.95 kDa

Protein length: 317 aa

Gene length: 954 bp

Function: acquisition of iron

Product: ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (binding protein) PubMed

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → ABC transporters → Importers → Uptake of iron/ siderophores
• Cellular processes → Homeostasis → Acquisition of iron → ABC transporters for the uptake of iron/ siderophores
• Metabolism → Additional metabolic pathways → Iron metabolism → ABC transporters for the uptake of iron/ siderophores
• Groups of genes → Secreted proteins
• Groups of genes → Membrane proteins

Gene

Coordinates: 182,370 183,323

The protein

Protein family

• Bacterial solute-binding protein 8 family (according to UniProt)

Domains

• Two independent non-symmetric globular domains, connected by a long alpha-helix (residues 143-164 of the mature protein).
• Fe/B12 periplasmic-binding domain (aa 57-317) (according to UniProt)

Modification

• FeuA is a lipoprotein with a N-acetyl-S-diacyl-glyceryl-cysteine structure PubMed

Structure

• 2PHZ, 2WI8, 2WHY (complex with ferri-bacillibactin)
• 2XUZ (complex with ferri-enterobactin)
• 2XV1 (complex with ferric mecam)

Localization

• associated to the membrane (lipoprotein) PubMed
• extracellular (signal peptide) PubMed

Expression and Regulation

Operons

• Genes: feuA-feuB-feuC-ybbA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Fur: repression, PubMed, in Fur regulon
  • Btr: activation, in the presence of the co-activators bacillibactin or enterobactin PubMed, in Btr regulon

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
  • induced by iron starvation (second wave to allow iron scavenging from the environment) (Fur) PubMed
  • expression of the operon is strongly induced at the beginning of biofilm formation PubMed

  Additional information

  • the presence of an iron-responsive element bound by CitB between feuA and feuB suggests iron-dependent regulation by CitB PubMed

Other regulations

• CitB: translation control,

Biological materials

Mutant

• BKE01630 (feuA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT, downstream forward: _UP4_AACTAATTCAGAGTAGGTTT
• BKK01630 (feuA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATCTATAGAGCCTCCTGTT, downstream forward: _UP4_AACTAATTCAGAGTAGGTTT

References

Loading